Music: The Arts - By David W. Deamer

OMNI Magazine, April 1983

C-T-G-G-G-C-G-T-G-G-T-G-G-C-T-C-A-C-A-C-C-T-G-T-A-A-T-C-C-C.

The sequence of letters above represents a biological mystery, just on the edge of our understanding about human evolution at the molecular level. If some of your DNA could be isolated and the order of its chemical bases determined, this sequence would appear again and again. It is the first portion of a repeating sequence of about 300 bases that is found throughout all the DNA of the human body. The significance of the sequences is not yet understood.

My research area is cell biology, and I happen to play a little piano. When a colleague showed me this sequence (which had just been discovered in his laboratory), the first thought that came to mind was that it could almost be musical notation. There were the notes of C (cytosine), G (guanine), and A (adenine), which represent three of the four bases found in DNA. If T, the symbol for the fourth base (thymine), were transposed into the note E, we would have four musical notes that fit nicely into the key of C. Furthermore, the notes form a C major sixth or A minor seventh chord, so that even an amateur pianist could improvise a bass accompaniment.

Could there really be a musical message in our genes? Or would it just be an unpleasantly random series of notes? I hurried home to find out. After a few false starts on the piano, it became apparent that some guidelines were necessary to define the musical freedoms I could take. First, the octave of a note should be free choice, since it would not matter to the sequence. Second, if two or more of the same bases appeared together in the sequence, the notes they represented could be blended into a half note (two beats), dotted half (three beats), or full note (four beats). Finally, the tempo and time (2/4, 3/4, 4/4) could also be free choice. The only binding rule was that a molecular biologist should be able to look at the music and read the exact sequence of bases in the DNA.

As I began to play again according to these rules, something remarkable happened. The notes began to make musical sense, and a delightful, waltz-like melody emerged (see score A below). By chance, the original discoverers of the chemical compounds of DNA happened to give three of the four bases names that could be transposed into musical notes in the key of C. Furthermore, the very first DNA sequence I tried to play immediately produced a melody that made musical sense. Could this be done with all DNA sequences?

Aware that the DNA sequence for insulin had just been published, I decided to try that. Insulin is a small protein containing two relatively short chains of polymerized amino acids, called the A and B chains. The sequence of amino acids in the B chain, together with its message sequence in DNA, is shown here:

PheValAsnGinHisLeuCysGlySerHisLeu
TTTGTGAACCAACACCTGTGCGGCTCACACCTG
ValGluAlaLeuTyrLeuValCysGlyGiuArg
GTGGAAGCTCTCTACCTAGTGTGCGGGGAACGA
GlyPhePheTyrThrProLysThr
GGCTTCTTCTACACACCCAAGACC

In the genetic code, each amino acid requires three bases in the DNA (the codon, or triplet) to code for its position in the resulting protein. For instance, one of the codon/triplets for the amino acid phenylalanine is three thymines in a row (TTT). If you check the first amino acid in the insulin chain, it is phenylalanine, and just below it you will see YYY, its codon in the DNA. Since the bases come in triplets in a gene, it seemed a good idea to play the notes as triplets as well. The first few bars of the melody appear thus (see score B at left).

Again it made a certain musical sense. The triplets give it the flavor of an Irish jig, and when the full protein is translated into music, the melody seems to have a beginning, a middle portion, and an end.

By this time I wanted to know a lot more about DNA, and particularly about the recent advances that have permitted base-sequence determination. Perhaps "music" is coded everywhere in our DNA. There is certainly plenty of it to look at. If all the DNA in one human cell could be arranged in a single strand, it would be about 1.5 meters long. Somewhere in all that DNA there must be a base sequence T-T-T-C-C-C-C-C-C-, and this could be played as the famous opening notes of Beethoven's Fifth Symphony.

A major breakthrough in molecular biology occurred a few years ago when a technique became available for determining the base sequence in a DNA strand. What has been learned is that there is considerably more DNA present in a cell than necessary to make a human being. We still don't know what all the excess DNA is doing, but at least the techniques for sequencing have given us some idea of what it looks like as well as an understanding of the sequence of bases in genes. Another surprising discovery is that the gene regions are much more complex than was expected. Instead of a single sequence of bases coding for each protein chain, it was found that pieces of the message were scattered about in the gene region with numerous other sequences in between. Even more remarkable are some of the sequences that are found outside the gene. A significant fraction of human DNA consists of the 300 base-repeating sequences that were described earlier, while another fraction is so unlike the rest of the DNA that it appears all by itself in certain isolation techniques; this is called satellite DNA.

This kind of order is rare in nature, and totally unexpected at the molecular level. Currently no one knows with certainty where such sequences come from or what their function might be. There are some guesses, of course. For instance it has been suggested that the repeating sequences are a signal. Some portions of the DNA in cells are called transposable elements, because they can be transposed from one region to another and thereby permit an organism to shuffle its genetic deck.

Another idea is that the repeating sequences are remnants of viral genes that "infected" the DNA and that they are carried along with the replication process. A more speculative explanation proposed by several scientists, including Francis Crick, the codiscoverer of the DNA double helix, is that the repeating sequences represent "selfish DNA." One can imagine that a certain sequence of DNA accidentally got lodged in the main DNA pool of an early cell and found itself able to reproduce more or less independently. Naturally it would do so until it had filled up as much of the DNA pool as it could without injuring the organism that it was inhabiting. Thus, selfish DNA would be of no use to the cell, but would be alive in its own primitive fashion, making it essentially a molecular parasite.

An even more intriguing idea, and one that will never appear in a traditional scientific journal, is that DNA, when it is not hard at work making proteins, whistles a little tune that we can decode as music. Want to try your hand? The base sequence of a satellite DNA fragment called BLUR 17 is shown here:

TCCTTAGCTTACCTTAGCTTACCTTGTTATTTACCTGAGGTTACCTTAGTAGATTACCTTAGCTCACCTTAGTAGC TTACCTGAGCTTACCTCAGTAGTAGGTTACTTTAGCCTACCTTAGTTACTTAACCTGAGCTTACCTTAGTAGCTCA CCTGAGCTTACCTTAGTAGTAGTTTACTTTATCTTACGTTAGTAGTTTACCTTAGCTTACCTTAGTAGTAGCTTAC CTTAGATTACCTTATT

The orderliness of the three and five base repeats is obvious at a glance. It forms a kind of rhythm that goes on throughout the sequence. If you are musically minded, you should be able to translate this into a genetic melody by using the notes A, C, G, and E (for T) and following the guidelines outlined earlier. Of course, the choice of notes is arbitrary, since no one had music in mind when the bases were named. Any other four notes could be assigned and would produce a different melody but the same rhythm will be present, reflecting the patterns of repeats in the sequence. Accompanying chords are improvised according to the musical "feel" of the melody.

By this time, if you are a knowledgeable biochemist or musician, you are probably thinking, This guy has got to be kidding. There can't be real music in DNA, just some patterns that happen to fall into interesting but arbitrary tone sequences. Well, that depends on what you mean by "music." The melodies shown here are musique trouvee ("found music"), analogous to l'art trouve of the artist. Beauty, in this case, is in the ear of the listener.